iκb kinase activation  (Thermo Fisher)

Journal: Cancers

Article Title: A Novel Protein–Protein Interaction between RSK3 and IκBα and a New Binding Inhibitor That Suppresses Breast Cancer Tumorigenesis

doi: 10.3390/cancers13122973

Figure Lengend Snippet: RSK3 interacts with IκBα and regulates its phosphorylation. ( A ) Two pairs of vectors, pKCδ-mRFP-IκBα/pAC-GFP-RSK3 or pKCδ-mRFP-RSK3/pAC-GFP-IκBα, were co-transfected into HEK293T cells, and CUPID analysis was performed using a Zeiss 710 Confocal microscope (LSM 710, Carl Zeiss, Germany) after treating with PMA (0.1 nM). The profiles obtained from the images were analyzed in the indicated directions. Scale bar: 10 μm. ( B ) Myc/His-RSK3 and pAC-GFP-IκBα were co-transfected into HEK293T cells, and RSK3 was immunoprecipitated. Co-immunoprecipitated IκBα was identified by Western blotting using a GFP antibody. Immunoprecipitation was performed three times. Representative results from three experiments are shown. ( C ) pACT-RSK3 and pBIND-IκBα plasmids were co-transfected into HEK293T cells, and a MTH assay was performed. Luciferase activity indicates the change in relative luminescence units normalized to the negative control. Statistical significance was determined by analysis of variance (Newman–Keuls test). ( D ) In vitro kinase assays were performed using inactive IκBα (100 ng)/active RSK3 (100 ng) or inactive IkBα (100 ng)/active IKKα (100 ng). Phosphorylated IκBα was detected by Western blot using a phosphospecific (Ser32) IκBα antibody. Representative results from three experiments are shown.

Article Snippet: Recombinant protein [activated RSK3, IKK (IκB kinase) and inactive IκBα] was obtained from SignalChem (Signalchem Biotech Inc, Richmond, VA, Canada).

Techniques: Transfection, Microscopy, Immunoprecipitation, Western Blot, Luciferase, Activity Assay, Negative Control, In Vitro

Journal: Cancers

Article Title: A Novel Protein–Protein Interaction between RSK3 and IκBα and a New Binding Inhibitor That Suppresses Breast Cancer Tumorigenesis

doi: 10.3390/cancers13122973

Figure Lengend Snippet: The CTKD domain of RSK3 binds to the N-terminus of IκBα. ( A ) Schematics of full-length and deletion mutants (DMs) of IκBα. ( B ) Full-length Myc/His-RSK3 and WT pAC-GFP-IκBα WT or DM#1–4 were co-transfected into HEK293T cells. RSK3 was immunoprecipitated, and co-immunoprecipitated IκBα was identified by Western blotting using an anti-GFP antibody. Representative results from two experiments are shown. ( C ) Schematics of full-length and DMs of RSK3. ( D ) Full-length WT Myc/His-IκBα and pAC-GFP-RSK3 WT or DM1–3 were co-transfected into HEK293T cells. RSK3 was immunoprecipitated, and co-immunoprecipitated IκBα was detected by Western blotting with an anti-IκBα antibody. Representative results from three experiments are shown. (** p < 0.01 and * p < 0.05 vs. WT RSK3).

Article Snippet: Recombinant protein [activated RSK3, IKK (IκB kinase) and inactive IκBα] was obtained from SignalChem (Signalchem Biotech Inc, Richmond, VA, Canada).

Techniques: Transfection, Immunoprecipitation, Western Blot

Journal: Cancers

Article Title: A Novel Protein–Protein Interaction between RSK3 and IκBα and a New Binding Inhibitor That Suppresses Breast Cancer Tumorigenesis

doi: 10.3390/cancers13122973

Figure Lengend Snippet: RSK3 activates NF-κB via phosphorylation of IκBα. ( A ) MDA-MB-231 cells were transfected with RSK3, and RSK-induced IκBα phosphorylation was analyzed by Western blotting using a p-IκBα (S32) antibody. Representative results from three experiments are shown. ( B ) NF-κB luciferase activity increased with expression of RSK3. HEK293T cells were co-transfected with 0.5 μg pGL3-NF-κB-Luc, 0.5 μg pcDNA3.1-RSK3, and 0.2 μg pCMV-β-gal. Luciferase activity was normalized against β-galactosidase activity (** p < 0.01 vs. control). ( C ) IκBα activation assay. HEK293T cells were inoculated onto a black 96-well plate. Cells were transfected with 100 ng of a RSK3 expression vector alone, the RSK vector and either a control or shRNA (AGGTCCTGAAGCGTCAAGGCTATGATGCG) targeting RSK3 or shRNA alone. IκBα kinetic activity assays were performed (** p < 0.01 and * p < 0.05 vs. control). ( D ) Kaplan–Meier curve shows that breast cancer patients with low RSK3 expression ( n = 208) have a better prognosis than those with high RSK3 expression ( n = 663) (Log rank p -value I = 0.018).

Article Snippet: Recombinant protein [activated RSK3, IKK (IκB kinase) and inactive IκBα] was obtained from SignalChem (Signalchem Biotech Inc, Richmond, VA, Canada).

Techniques: Transfection, Western Blot, Luciferase, Activity Assay, Expressing, Activation Assay, Plasmid Preparation, shRNA

Journal: Cancers

Article Title: A Novel Protein–Protein Interaction between RSK3 and IκBα and a New Binding Inhibitor That Suppresses Breast Cancer Tumorigenesis

doi: 10.3390/cancers13122973

Figure Lengend Snippet: RSK3I inhibits the binding of RSK3 to IκBα. ( A ) A three-dimensional model of the RSK3 structure and the RSK3/IκBα binding inhibitor RSK3I. ( B ) Chemical structure of RSK3I. The molecular weight is 661.791 Da. ( C ) MTH assays were performed by transfecting pACT-RSK3 and pBIND-IκBα into HEK293T cells. RSK3I was added 4 h after transfection in a dose-dependent manner. Luciferase activity was measured 24 h after transfection (* p < 0.05 relative to mock). ( D ) RSK3 in vitro kinase assays were performed with dose-dependent treatment of RSK3I (1 μM and 10 μM). IκBα phosphorylation was detected using Western blot analysis. Representative results from two experiments are shown. ( E ) Immunoprecipitation used RSK3 or control Ig-G antibodies in HEK293T cells transfected with Myc/His-IκBα and pAC-GFP-RSK3. RSK3I was added in a dose-dependent manner (0.1 μM, 0.5 μM, 1 μM, and 10 μM). DMSO was used as a vehicle control (MOCK). Co-immunoprecipitated IκBα was identified by Western blotting with an IκBα antibody (* p < 0.05). Representative results from three experiments are shown.

Article Snippet: Recombinant protein [activated RSK3, IKK (IκB kinase) and inactive IκBα] was obtained from SignalChem (Signalchem Biotech Inc, Richmond, VA, Canada).

Techniques: Binding Assay, Molecular Weight, Transfection, Luciferase, Activity Assay, In Vitro, Western Blot, Immunoprecipitation

Journal: Cancers

Article Title: A Novel Protein–Protein Interaction between RSK3 and IκBα and a New Binding Inhibitor That Suppresses Breast Cancer Tumorigenesis

doi: 10.3390/cancers13122973

Figure Lengend Snippet: RSK3I inhibits tumorigenesis and increases apoptosis in breast cancer cells. ( A ) The basal expression levels of RSK3 and IκBα in breast cancer and normal breast epithelial cell lines were analyzed using Western blots. Representative results from two experiments are shown. ( B ) Cell viability was analyzed using a CCK assay. RSK3I was added at concentrations of 0.1 μM, 1 μM, and 10 μM for 24 h. ( C ) Foci assays were performed to analyze the growth of breast cancer cells (MCF7, MDA-MB-468, and MDA-MB231). Cells were incubated with RSK3I for 14 days and stained with 0.5% crystal violet. Cell counting was performed using the ImageJ (Java-based image processing program) tool. ( D ) Wound-healing assays were performed to analyze the effect of RSK3I on the migration of MDA-MB-231 cells. The cells were treated with several concentrations (0.1 μM, 1 μM, and 10 μM) of RSK3I, and cell migration was monitored for 48 h. ( E ) The effect of RSKI on apoptosis was assessed by Annexin V/PI staining followed by flow cytometry analysis. RSK3I was added to breast cancer cells (MCF7, MDA-MB-468, and MDA-MB-231) or a normal breast epithelial cell (MCF10A) at concentrations of 1 μM and 10 μM for 24 h, and DMSO was used as a control.

Article Snippet: Recombinant protein [activated RSK3, IKK (IκB kinase) and inactive IκBα] was obtained from SignalChem (Signalchem Biotech Inc, Richmond, VA, Canada).

Techniques: Expressing, Western Blot, Incubation, Staining, Cell Counting, Migration, Flow Cytometry